Immune Deficiency Foundation (IDF) Advice on H1N1 Influenza

The IDF has just published Swine Flu and You: What Patients with PIDD Need to Know which may be of interest.

SwineDeathPlague In Perspective

(ps. xkcd rocks - go and read it on Mondays, Wednesday and Fridays!)

Pandemic 'Flu

As readers will doubtless be aware, the World Health Organisation pandemic alert stands at level 5, which is potentially a precursor to a pandemic (level 6), and countries are gearing up to ensure the response to the outbreak if effective, efficient and clearly communicated.

Before talking about what you should do, I think it's worth making the point that at the moment we have very few cases in the UK (5:60,000,000), which is a tiny fraction of the UK population. At the moment, it is highly unlikely that you will have come into contact with someone infected with H1N1 influenza virus (aka swine 'flu, Mexican 'flu).

The Department of Health (DH), Health Protection Agency (HPA) and National Health Service (NHS) have been planning for pandemic 'flu for more than 5 years, and the NHS will take the lead in implementing the plan.

It worth noting that the response to crises of many types has been practised on many occasions. In the UK, the Civil Contingencies Act, which places a duty on many agencies to plan for public emergencies, has been in operation for a number of years, and the response to different situations is well practiced; for those who are interested I will prepare a later post on this topic.

As the pandemic plan is put into operation, stores of oseltamivir (aka Tamiflu) and zanamivir (aka Relenza) will be distributed to appropriate agencies. You will shortly be receiving a leaflet from DH outlining what your response should be, there is additional information at NHS Choices which may be of interest.

If you have flu-like symptoms, and have either returned from Mexico or another affected area or been in contact with someone who has you should ensure other people are not affected by phoning NHS Direct (0845 46 47) and not attending your GP surgery.

To prevent spread, you should practice good hygiene, as I know most people with primary immunodeficiency already do routinely.

In order to effectively prepare for the pandemic, you should:

• Establish a network of "flu friends" who can help if you come down with the illness.
• Ensure you have about two weeks worth of food and 'flu remedies.

As a slight aside, I personally recommend not worrying about "branded" drugs; the cheaper "supermarket brand" will do; I'd also not go with combination products (such as LemSip) because they're often not full dose. Consider paracetamol, ibuprofen, pseudoephedrine (Sudafed - sometimes only available branded): you know which drugs you can take. Don't forget to get paracetamol and ibuprofen suspension for children.

Once the pandemic is confirmed, there are rules on the issuance of antivirals.

The NICE (National Institute of Health and Clinical Excellence) guidance for prescribing antivirals when influenza is circulating in the community are:

oseltamivir and zanamivir are recommended to treat at-risk adults who can start treatment within 48 hours of the onset of symptoms; oseltamivir is recommended for at-risk children who can start treatment within 48 hours of the onset of symptoms.

The definition of "at risk" is:

At-risk patients include those aged over 65 years or those who have one or more of the following conditions:

• chronic respiratory disease (including chronic obstructive pulmonary disease and asthma)
• significant cardiovascular disease (excluding hypertension)
• chronic renal disease
• immunosuppression
• diabetes mellitus

Prophylactic (preventative) therapy is indicated in at-risk patients when they "have been in close contact with someone suffering from influenza-like illness in the same household or residential setting".

Oseltamivir is available both as a capsule and in a sugar-free tutti-frutti flavour suspension (syrup) for children. Zanamivir is taken as an inhaled powder and is suitable for both adults and children over the age of 5.

If you need to seek help for a person with an immune deficiency who has 'flu-like symptoms, you should mention they are immunodeficient when you contact NHS Direct or your GP.

If you have concerns about attending school or work, the current advice is that staying off school (or work) is not necessary, but if you are concerned about your child you should discuss your concern with the head teacher.

ALL THIS SAID, I remain convinced there is no need to panic. Most people who have had this disease have been poorly, but it doesn't seem to have a very high mortality rate. The biggest risk is transmission, which is controlled by good hygiene; panic will tend to prevent good hygiene.

Good luck and keep your hands clearn!

But is it a hamdemic?

Just thought I would draw your attention to the World Health Organisation's pandemic phase system, which can be found on the WHO's website. We're currently in phase 5 which suggests that we may be facing a pandemic. However, that is not a reason to panic: we still don't understand what that means as we don't yet have an insight into the morbidity (rates of illness) or mortality (rates of death) associated with H1N1 inflenza virus.

Storm: Why PIDers may be better off...

A couple of people asked why people with PIDs might be more likely to survive a 'flu pandemic.

Immunocompetent people respond to infection in a numbers of ways simultaneously, one of which is the complement system. However, the complement system can also be activated by the actions of antibodies: this was graphically demonstrated in the TGN1412 tragedy in which the monoclonal (ie: identical) antibody caused the complement system to over-react by causing a "cytokine storm".

The complement system is activated by a cascade of proteins (cytokines, a type of signalling molecule), each of which activates the next protein in the chain. In fact, each parent protein in the chain activates many of their child proteins.

When this cascade isn't regulated (eg. by feedback turning off the parent proteins), it becomes an uncontrolled "storm", resulting in massive, rapid inflammation, oedema (water swelling), vasoconstriction (reduced blood flow) and shock.

The hypothesis is that this type of reaction causes many of the serious complications in healthy, young people. This is the pattern of fatality that was seen in the 1918 Spanish Flu pandemic, in which working-age, healthy men had higher mortality rates than any other group.

However, there may be other explanations as to why that group had higher mortality rates - not least of which is that this is the group perhaps most likely to mix together and most likely to attend work when unwell. So it's far from clear that the hypothesis is proven, and even then it might be just part of the explanation.

The logical extension of the hypothesis is that if you have certain immune problems, this might reduce your susceptibility to this type of reaction, which would confer a survival advantage on those of us with those immune problems. However, it's difficult to say at this point in time whether that is relevant to the current outbreak of swine flu.

In short, we may have an advantage but it's far from clear. If we do, I think we'll all be relieved that, for one, the PID is giving something back.

Not so hot...

Feeling a tad under the weather today - viral pharyngitis - doc gave me a gargle to use to reduce symptoms and opportunistic infections.

First thing the doc asks? "What do you think to this swine flu then? How will it affect you?"

"Well, doc, it's been suggested, although it's far from clear, that my crappy immune system might mean I don't have the same sort of problems that healthier people with normal immune response will get."

"Hmmmm," he says. He also said that he has two child patients with a PID on his books (bear in mind most GPs will see 1 PID patient in their career).

Towards the end of the consultation, after he's peered into my ears and down my throat, confirming what I already told him, I add to my original reply.

"When someone can sneeze in Airdrie and infect me in Sheppey, I'll start worrying about it."

Mind you, imagine what that would mean for the space in between Airdrie and Sheppey! I mean, that's a lot of snot...

BBC Q+A on Swine Flu

CDC Twitter

If you're in the US and interested in the Swine Flu outbreak, you might want to follow cdcemergency on Twitter!

Flu Outbreak

Many of you will have heard about the recent out break of swine influenza H1N1 in Mexico, which appears to have spread to the USA and Canada.

I am working on a piece on how this is likely to affect people with PIDs, but in the meantime would like to stress that basic hygeine will likely protect you from most contagious diseases, including 'flu.

• If you cough or sneeze, ensure you cover your nose and mouth. 'Flu virus reproduces in the respiratory tract, and is spread through droplets when people cough and sneeze.
• Discards tissues or other receptacles quickly and hygeinically. 'Flu virus can stay infectious for sometime in a moist environment, so disposal of contaminated material is important.
• Practice regular hand-washing. Ensure you use hot water and soap, and ensure your hands are thoroughly dried.
• Clean hard objects on a regular basis. Wipe door handles, light switches and other common touched objects off once or twice a day. This doesn't need to be with anything high powered, but a normal cleaning product.
• Ensure your children follow this advice!

This advice is taken from the Health Protection Agency's website, and more information is available there.

I will post more when I have more information.

How complementary or alternative therapies become Medicine

Originally posted in response to a discussion on complementary and alternative therapies.

I welcome any product which has a beneficial therapeutic effect into the realm of Medicine (capital M). If someone demonstrates, scientifically, that, for example, Manuka honey has a sustained, positive effective on the regulation of (in this case) neutropenic cells, then that is Medicine and will likely become part of the standard therapeutic protocol for neutropenics.

For me the issue isn't that might or might not be an effect caused by products in "naturopathic" products, but that claims about them are being made without scientific evidence. If you want to develop a new therapeutic product and market it, there is a process through which you must travel, whether you are making claims about ibuprofen, IVIG products, antibiotics or naturopathics.

1. The developer/promoter has to demonstrate the therapy causes less harm than the condition it purports to treat.
2. The developer/promoter has to demonstrate the therapy causes the therapeutic effect it claims to cause.
3. The developer/promoter has to demonstrate the therapy has a benefit which no existing therapy for the condition has. For example
   • It has a greater therapeutic effect than existing therapies
   • It has fewer side-effects than existing therapies
   • People who cannot take existing therapies are able to take the new therapy

Let's exemplify this using Manuka honey. I'm going to assume that (1) has been fullfilled on the basis that lots of people eat honey, although there are issues here: some people do have problems eating honey, and honey which isn't pasteurised can become a reservoir for pathogens, but let's assume we have passed this stage. Obviously, this stage is important, as the research a couple of years ago into a particular monoclonal antibody demonstrated, where participants (except the control) reacted extremely unfavourably to the product.

Therapeutic claims (2) and (3) are more of a challenge. We have already noted that the placebo effect occurs; there's not (in my opinion) enough research around the placebo effect and how it works, but, for example, in 15% of people a sugar pill is as effective a codeine (a relatively mild opiate) in pain control. So it's clearly important that one is able to differentiate between the placebo effect and the effect of the therapy.

The only way that we have to differentiate at the moment is through double-blind trials. A double-blind trial is where neither the people administering care to the patient nor the patient themselves know whether they are getting the new therapy or a placebo. This prevents the carers from treating the patient differently depending on whether they are on the "real" stuff or not (such differences are typically unconscious but demonstrable when the therapy is only single-blind), and allows the experimenters to differentiate between effects reported by the test (therapy) group and the those reported by the control (placebo) group.

In one study, the product being explored was a painkiller and they carried out a pseudo-double-blind experiment. It was set up as a double-blind (so the patients and the nurses were not told what product the patient would be getting), but they put a twist on it and "accidentally" revealed to half of the test group and half of the control group that they were getting the real therapy (I think they did it by putting red dots on their folders or something, it was quite clever). This left them with four groups: Test A (actual therapy, ignorant), Test B (actual therapy, knows), Control A (placebo, ignorant), Control B (placebo, thinks getting active ingredient). Test B showed the greatest effect, followed by Test A and Control B (about the same) and then Control A.

In short, a proper double-blind test is required to remove the mind of the patient and carers from the investigative equation. Obviously, this has to be done ethically (all participants must be told that they may or may not be getting the active ingredient), and convincingly (this was challenging with acupuncture, but they came up with a way of delivering blind needle inserts or skin pressure which were indistinguishable to participants), but without it you don’t know if you are measuring the response of the patient’s brain to the therapy, to the behaviour of the carer or to knowledge.

Until a series of double-blind tests have been carried out, making a claim about the therapy as to (2) or (3) is impossible. Once that claim is asserted (for example, "SCIG reduces joint pain and incidence of infection in adult patients with CVID and is better tolerated than other therapies") to the satisfaction of the scientific community (typically represented by regulatory bodies, such as the MHRC in the UK or FDA in the US), with a satisfactory safety profile, then a licence is issued.

Uses for other reasons (eg. use of SCIG in some autoimmune conditions) are "off-licence" until the company have demonstrated that the condition also responds favourably to the treatment (in fact, SCIG would be unlikely to have a sufficient effect on many autoimmune conditions compared with IVIG because the dose for autoimmune diseases is typically significantly larger than in, say, CVID).

So, with regards complementary and alternative therapies, UNTIL they have fullfilled the requirements listed above, they are considered folk medicine (lower case m) and are outside the realm of Medicine (capital M). I would now consider St John's Wort, as an example from the above, part of Medicine because someone has done some research (and in fact you should find that St John's Wort now has warnings that it shouldn't be taken with certain antidepressants).

Someone suggested that pharmaceutical companies wouldn’t undertake this research because the results are not patentable, so they wouldn’t make any money. I would firstly make the point there is no reason it has to be "big pharma" doing biomedical research. This is exactly the type of research which it is ideal for governments to fund as it is clearly in the interests of the citizens for them to be protected from bogus claims and to gain the benefits of patent-free therapeutics.

That said, "big pharma" are doing research in this area and examining molecules from biologicals (term for folk medicines) to see if they have actual therapeutic effects. Once that is established, they explore why and then try to find a derivative molecule which is more potent and/or safer than the original: the derivative molecule is patentable and could be a source of significant income. This was the pattern seen in the 1950s with the explosion of antibiotic drugs.

To summarise, once therapies have been proven to be effective, they are no longer "complementary" or "alternative", just Medicine. It can be difficult to differentiate between placebo and actual effects because the human brain is so dynamic and adaptive. I don't object to people using complementary and alternative medicines, provided they don't make claims about them, particularly (and I don't think this was the case in this event) where those claims are intended to promote or sell a product. Exploring the complementary/alternative therapies domain provides a pool of untapped folk knowledge and therapeutics which may provide future breakthroughs in therapeutic opportunities.

Open Mindedness

Just writing that piece on complementary and alternative medicine, I rememberd this video, which seems strangely appropriate.

Complementary and Alternative Medicine

I'm gonna start by saying I'm a scientist and I find the concept of Complementary and Alternative Medicine (CAM) laughable.

First, the church of medicine is broad and deep and includes any therapeutic techniques that have been shown to work. So there is simply no need for a separate branch of therapies which either claim to be an adjunct for "regular" medicine or which are effective but not compatible with "mainstream" therapies.

Secondly, the claims of various branches of CAM therapies are, frankly, astonishing and exceed those of the tried and tested therapies available elsewhere.

Thirdly, the claims of CAMs are unscientific. Unscientific in this context means contrary to accepted scientific theory* at best or agnotologistic** at worse.

For example, homeopathic theory relies on principles which are directly in competition with our understanding of pathology and physiology. Acupuncture and other techniques rely on the concept of "chi" which has never been detected. Aromatherapy is just laughable (if chamomile is so soothing, why isn't it used by paramedics to care for people with serious injuries?).

The reason I mention it is that I have again seen someone claiming immunotherapeutic effects for an improbable substance: this time it's honey. Sorry, manuka honey, not any old honey!

And whilst I appreciate that the honey may have a placebo effect which helps some people (as do any/all of the CAM techniques), it's not going to have the effect of permanently improving immune response.

So please, don't tell people with PIDs that all they need to do is take some snake oil product: you're just making yourself look foolish.

* Unlike the common use of the word "theory", in science, a theory is an explanatory hypothese or model which has been shown to stand up to experimental reality time and time again. For example, gravitational theory, atomic theory, germ theory, evolutionary theory.

** Agnotologistic is the deliberate spreading of ignorance for gain, whether personal or social.

Dire Rear

I was listening to the news this week, and they were talking about the new over-the-counter weight-loss tablet, orlistat marketed as Allī. I think anyone who has heard about the product will have heard about one of its side-effects, described on the Today programme as "stool leakage".

In my experience, most people with PIDs have suffered from the runs at some point or another, often to the point of it being excruciatingly embarrassing. Worse: the runs can actually be a side effect of some of the drugs, particularly antibiotics, on which we depend, so sometimes the cure becomes as torturous as the original problem.

For example, I've just started on doxycycline and have been treated to a visit from the squitsmonster (always a pleasure, never a chore) in order to treat sinusitis. I could control the inconvenience of sinusitis with application of Sudafed - controlling the trots is more of a challenge.

So to anyone who is suffering or has suffered down below, you're not the only one. We stand by you in your hour of need, and will pass you the wet wipes when you're done. Metaphorically.

If anyone wants to share their diarrhoea stories, feel free to do so in the comments!

Bacteria Talk...

So it turns out bacteria are quite chatty! A great introduction to bacterial quorum sensing and the future of antibiotics!

SPUR Infections

I mentioned SPUR infections yesterday: why are they important and how do you know what you're looking at falls into this category?

SPUR is an acronym standing for:

• Serious
• Persistent
• Unusual or
• Recurrent

Serious infections are those which are potentially life-threatening. You could include in that, for example, pneumonia and meningitis, all of which are always serious. More indicative, however, is when what is normally a mild infection, such as tonsilitis, becomes serious, such as quinsy (aka. peritonsillar abscess).

Persistent infections are those which don't clear up when appropriately treated. So, for example, tonsilitis which isn't responding to amoxycillin.

Unusual infections are those which wouldn't normally arise in that population. For example, Kaposi's sarcoma and Pneumocystis carinii pneumonia don't arise in people with functioning immune systems, and presence of these should suggest that immune problems should be investigated.

Recurrent infections are those which appear to be resolved, but which come back time and time again. This is normally because the bacterial population has dropped below the pathological threshold (most bacteria only cause disease when there are more than a given number of them). In a person who is immunocompetent, those bacteria would be tagged by immunoglobulins and then destroyed by macrophages. In people with immune problems, they regroup and start recolonising, causing the infection to flare back up.

SPUR infections are important because they suggest that something abnormal is happening which needs to be investigated. Typically it will be something inoccuous or just "bad luck", but once in a while someone with SPUR infections will turn out to have a PID...

Common Variable Immunodeficiency: Not That Common

This is really only my first post on here, the other posts being reposts of answers to questions on the PiA Discussions Forum (if you have a primary immune problem and haven't yet done so, take a few moments to visit and introduce yourself!).

So I thought it appropriate that my first post be about my diagnosis: common variable immunodeficiency, or CVID as it's most commonly known. The first thing I'd like to stress is that CVID isn't common in terms of incidence: that is to say it's quite a rare disorder.

What is CVID?

In fact it's not even 'a' disorder: it's a big old collection of about 20-30 disorders which have shared features and treatment plans. That's where the "common" bit comes in: there are common variances in the immune systems of us with CVID.

In other words, CVID is what I term a bucket diagnosis. Bucket diagnoses are useful when they are used appropriately as they allow appropriate treatment and monitoring whilst discovering the underlying problems.

So what are those common variances? Patients with CVID always have low IgG levels, and normally have low IgA and may also have low IgM levels (for more details on immunoglobulins, see my post, Immunoglobulins: proteins that play tag). Functional antibody (FAb) tests typically reveal that antibodies produced are effective, but may reveal that antibodies against certain types of pathogens aren't produced (for example, my body is quite happy fighting Clostridium tetani (tetanus), but doesn't like Pneumococcus sp. in the slightest). CVID patients typically have a normal white blood cell count (T and B cells); patients which do not typically have low B cell count and these patients typically have atypical X-linked agammaglobulinaemia.

A patient with CVID (or indeed many other PIDs) will typically have a history of

• Serious
• Persistent
• Unusual or
• Recurrent

infections. Typically, such infections in CVID patients tend to be bacterial in nature (for reasons which will hopefully become apparent), and the most commonly reported infections are respiratory tract infections (sinusitis, tonsilitis, bronchitis, pneumonia) and digestive tract infections.

Chest infections can cause long-term damage to the lungs (most commonly bronchiectasis), whilst in children the digestive problems can cause "failure to thrive" because the prevent the child absorbing essential nutrients.

CVID affects about 1 in 10,000-50,000 people; the reason for this broad range is that many people are undiagnosed. This means that there are between 1,200 and 6,000 people with CVID in the UK, or between 6,000 and 32,000 in the United States of America. This represents about 50% of the cases of primary immunodeficiency (OK, you could argue that makes it common, but I'm so not common!).

So, What’s Broken?

We've established that CVID is characterised by low levels of antibody, but what causes CVID? That's a good question. It's highly likely to either be genetic or to have a strong genetic factor. First, let's have a quick look at the natural history of the antibody.

In the image to the right you can see that there are several cells involved before antibody production can occur.

The main cell is the B cell, which take samples of antigen and develop antibodies to it. T Helper 2 (TH2) cells verify that the antigen is foreign, and when they recognise an antibody for a pathogen which is active they stimulate the B cells to divide.

Most of the daughter B cells become plasma cells, which churn out thousands of antibodies. The remainder become B memory cells which hang around in lymphoid tissue (ie. in lymph nodes) waiting to be activated and produce antibody if reactivated.

You can see that there are lots of places at which this process could breakdown: TH2 to B cell signalling, B cell to TH2 presentation, B cell differentiation, antibody production or memory B cells reactivation.

So which breakdown in CVID? Uhm, well, probably all of them. CVID is a bucket diagnosis precisely because we don’t know what all of the problems are!

However, scientists recently identified some genetic mutations which appear to cause CVID, of which the most important is the TACI mutation, which responsible for about 10% of cases.

TACI (transmembrane activator and CAML interactor, well you did ask…) is a surface protein on B cells which facilitates switching between different isotypes (IgG, IgM, IgA are each isotypes) of immunoglobulin. TACI is also responsible for some selective IgA deficiency (SIgAD) cases, which explains at least one relationship between SIgAD evolving to CVID.

Other genetic mutations include BAFF-R (a defect on a B cell surface protein), ICOS (a defect on a TH cell surface protein) and CD19 defects (a B cell surface protein defect). Professor Grimbacher’s research at the Royal Free Hospital has indicated that there may be other links to T cell defects as a result of increased complications of Epstein Barr Virus infection in patients with CVID (although interestingly the actual infection rates in CVID patients mirror those of the general population, about 50%).

How Can We Fix It?

At the moment there are no permanent fixes, but we can treat the symptoms quite successfully.

The main treatment is the recognition and appropriate treatment of infection, particularly bacterial and protoctist (parasitic) infections. Typically, this involves a high-strength, extended course, broad spectrum antibiotic. If this doesn’t affect the infection, the doctor should prescribe a second course of a different antibiotic and order a culture of the appropriate bodily fluid (eg. throat swab, nasal mucus sample, faecal sample etc…). It is antibiotics that save lives in CVID; everything else is about quality of life.

Commonly, patients with CVID are given immunoglobulin infusions, a topic which warrants its own post. These “top up” the levels of antibody which are missing by using antibodies taken from blood donations. These help prevent infections, and also appear to control aches and pains which are common in CVID patients.

CVID patients should see their specialist at least once a year, get regular (eg. annual) lung function tests and abdominal ultrasound scans, with CT scans every few years. The appointment with the specialist should involve a full body examination; this is because some people with CVID are prone to higher rates of abnormal tissue growth which can lead to malignant growths if undetected.

Some patients with CVID also have autoimmune conditions (such as lupus or rheumatoid arthritis), and the various specialists should talk to each other to decide the best treatment protocols (typically, autoimmune disorders are treated using immune supressants which may cause issues in people with already poor immune systems!).

All that said, CVID patients without serious complications can expect a good quality of life and normal life expectancy.

That’s me done for tonight; I’m going to have a mix of longer posts and shorter posts, but for obvious reasons we seem to be starting with the longer ones…

Viral Defence: Natural Killer (NK) Cells and Tc Cells

This was originally posted as a response to a question on NK cells.

NK and Tc Cells

NK cells, or "large granular lymphocytes" as they are also known, and cytotoxic T (Tc) cells have related function. One textbook refers to them as the Police and Secret Police of the anti-viral world.

Tc cells identify viral infection by inspecting the target cells credentials. Each cell has an "antigen presenting complex" (also known as the major histocompatibility complex, or MHC) which samples some of the proteins in the cell and presents them for inspection by the Tc cells. If the Tc cell detects "foreign" protein (such as when a virus has hijacked the cell), it tells the infected cell to commit suicide (apoptosis), thus confounding the virus's plans for world domination.

However, some viruses (HIV and adenovirus, as two examples) play dirty and instead of allowing this to happen, they prevent the MHC from existing at all. This means the Tc cells can't inspect them, and that's where NK cells come in.

NK cells kill cells which DON'T present their credentials - their cytotoxic role is inhibited when a protein called "Killer Inhibitory Receptors" interact with the MHC.

However, NK cells can use immunoglobulins to detect infected cells: they achieve this by having an adaptor on their surface which can attach to the tail of IgG, so they work with antibodies to identify and kill virus-infected cells.

Tc and NK cells both have a number of techniques for killing cells. They typically use apoptosis : they either instruct the cell to commit suicide - apoptosis - or (if that fails) they release a protein which punches holes in the cell's outer membrane - the protein is called "perforin". Not only does this mean the cell starts leaking (which results in death), but the cells are then injected (through the perforation) with enzymes which override the cell and initiate the apoptosis sequence.

Dramatis personae: the cells of the immune system

This is a quick table of the cells of the immune system; as I write about each of them, I will link off to detailed posts. Do leave a comment if you have a question about a particular cell!

Cell	Brief description
Mast cell	Involved in inflammation and allergic reaction.
Basophil	A polymorphonuclear leukocyte involved in the control of inflammatory reactions.
Eosinophil	A polymorphonuclear leukocyte involved in defences against parasitic worms.
Neutrophil	A polymorphonuclear leukocyte involved in defences against bacteria.
Macrophage	Mobile cells involved in the identification and destruction of pathogens.
Phagocyte	Fixed cells involved in the identification and destruction of pathogens.
Dendritic cell	Highly mobile cells involved in the identification of pathogens.
T cell	Lymphocyte involved in immune system regulation (Th cell) and viral defence (Tc cell).
B cell	Lymphocyte involved in the production of antibodies.
Natural killer (NK) cell	Lymphocyte involved in viral defences.

Introduction to Genetics and X-linked agammaglobulinamia (XLA)

This is intended to provide a quick introduction to genetics, and give people an opportunity to ask questions! This was originally posted as a response to a question about X-linked agammaglobulinaemia...

Genetics: The Basics

At the heart of genetics is the need to move from a gene to a protein: you can think of genes as the instructions to build a protein. Each gene codes a single protein; the gene BTK, which is properly known as Bruton's tyrosine kinase gene, is translated into the protein BTK, and it is this gene which is faulty in the case of XLA.

Genes are made up from 4 molecules, known as nucleotides) strung together: thymine, adenine, guanine and cytosine, normally abbreviated to T, A, G and C. When in the form of double-stranded DNA, which is shown as the spiral in graphics, the T and A and the G and C fit together like the teeth on a zip. You can imagine nucleotides as similar to four different colours of Lego bricks stacked up on top of each other

Proteins, on the other hand, are made up from amino acids which are strung together - there are 20 amino acids which make proteins in the human body; again, you can imagine these as being a bit like 20 different colours of Lego bricks stacked on top of each other. Once the amino acids have been strung together, they spring into the correct shape to do their job. If they are in the wrong shape, they cannot carry out their intended function.

In order to get from a gene to a protein, information is first transcribed from DNA to messenger RNA. For some unknown evolutionary reason, RNA uses uracil (U) instead of thymine (T), but otherwise, the mRNA transcription is identical to the original DNA.

Once the mRNA has been transcribed, it leaves the cell nucleus (where the DNA is stored), and undergoes an editing process. Editing is necessary because genes have sections called introns and exons, but only the exons code for the protein, so the introns are stripped out.

The edited form of the gene attaches to protein-making factories called ribosomes in the main part of the cell. The ribosome then translates the genetic information into proteins by joining together the amino acids in the order specified by the gene.

You will have noticed that there are more amino acids than nucleotides, so how does the cell solve this problem? Instead of reading just one letter at a time, the ribosome reads words which are three letter long, and these words are known as codons. Given four letters read three-at-a-time, this gives 64 different codons (words) which are translated into the 20 different amino acids.

Of particular interest are the codon AUG, which indicates the start of a gene, and three codons (UAA, UAG and UGA) which indicate the end of a gene - you can think of them as genetic punctuation.

It is therefore the codons which make the gene, and small errors in the original DNA, in transcription to RNA and translation to proteins can make large differences to the resulting protein. Why? Consider the following stretch of DNA:

DNA: GATAGCGTTACCAG

This is transcribed to read as

RNA: GAU-AGC-GUU-ACC-(AG)

which translates into

AA: Asp-Ser-Val-Thr

Asparagine, serine, valine and threonine are 4 of the amino acid building blocks (AA stands for amino acid).

However, lets say that the ribosome started reading at the second letter:

DNA: GATAGCGTTACCAG RNA: (G)-AUA-GCG-UUA-CCA-(G) AA: Ile-Ala-Leu-Pro

As you can see, the protein is completely differently from the first one, despite the fact that it consists of the same code.

Now lets assume that the ribosome starts reading at the third letter:

DNA: GATAGCGTTACCAG RNA: (GA)-UAG-CGU-UAC-CAG AA: STOP-Arg-Tyr-Gln

When translated, UAG is a special codon which means STOP, so in this case the ribosome would read STOP and detach from the gene, stopping translation and leaving you with a very short protein!

When a gene mutates (I'm using this word in it's proper sense to mean "a change" as opposed to an X-Men sort of mutant ), it can result in a number of different changes to the gene; as a result, the protein changes. Because each amino acid has its own characteristics (shape, electrical charge, size), swapping just one amino acid for another can result in a protein which has a completely different, and non-functional, shape.

The type of change illustrated above is called a "frameshift"; if you imagine that the ribosome views the gene through a little window frame you can see that the frame has shifted in all three examples.

Another type of mutation is the deletion; a famous example of deletion is called CCR5-Δ32 (Δ is the greek letter delta and means "deletion" in genetics) where 32 nucleotides are missing from the CCR5 gene. CCR5 codes for a protein which is involved in response to inflammation.

Oddly, this doesn't cause people any ill-effects (people with the Δ32 variant are perfectly healthy). However, people with the CCR5-Δ32 variation are resistant to HIV which uses CCR5 protein as a gateway to infect cells. So some mutations have a beneficial effect.

You might have realised that removing 32 nucleotides is a problem for the reading frame because deleting 32 doesn't delete a whole number of codons. In fact, as a result of this deletion, a stop codon is introduced, resulting in the CCR5 from the Δ32 gene only being about half the length it should be. Protein quality control systems recognise that this is abnormal and just recycle the amino acids, so in this case a combination of a deletion and a frameshift result in none of the protein being used.

Another type of mutation is known as Single Nucleotide Polymorphisms or SNPs (pronounced "snips"). This is where one nucleotide is substituted for another.

Using our example above, this might be as follows:

Original: GATAGCGTTACCAG --> GAU-AGC-GUU-ACC-(AG) --> Asp-Ser-Val-Thr

SNPd: GATGGCGTTACCAG --> GAU-GGC-GUU-ACC-(AG) --> Asp-Gly-Val-Thr

As you can see, changing one nucleotide (fourth) resulted in glycine (Gly) being substituted for serine (Ser) in the protein product; this may well result in the resulting protein being unable to do it's job. This is known as as a mis-sense mutation.

The following example has a change, but it doesn't affect the resulting protein because the change codes for the same amino acid. This is known as a same-sense mutation:

Original: GATAGCGTTACCAG --> GAU-AGC-GUU-ACC-(AG) --> Asp-Ser-Val-Thr

SNPd: GATAGAGTTACCAG --> GAU-AGA-GUU-ACC-(AG) --> Asp-Ser-Val-Thr

This final example also has a change; in this case it introduces a stop codon, and this is known as a non-sense mutation:

Original: GATAGAGTTACCAG --> GAU-AGA-GUU-ACC-(AG) --> Asp-Ser-Val-Thr

SNPd: GATTGAGTTACCAG --> GAU-UGA-GUU-ACC-(AG) --> Asp-STOP

X-Linked Agammaglobulinaemia

In XLA, there is a mutation known as Q15X; this is defined as: "a non-sense mutation in exon 2 of BTK leading to stop codon in the PH domain."

We can start to make sense of this: we know that a non-sense mutation results in a stop codon; we known that the exon is the bit of the gene which codes for the BTK protein, so this now means all we need to know are what the BTK protein does, and what a PH domain is.

BTK is an enzyme (Bruton's tyrosine kinase), and whilst we don't know exactly what it does, it is essential for the maturation of B-cells, and is also involved in the activation of mast-cells (which are activated during inflammation.

BTK-Q15X is cut in the section with interacts with chemicals outside the cell (the PH domain), and cannot do it's job effectively. In fact, the name "Q15X" gives us a hint as to what's actually happened at the gene code level, and I have put the first 17 codons (51 nucleotides) of BTK below, and demonstrated the change - it's in the third group from the end of BTK-wt (which stands for "wild type", or the type seen most frequently in the population), and you can see in BTK-Q15X that the SNP results in a stop codon (UAA) appearing.

Amino acids also have one letter abbreviations, and the abbreviation Q = Gln = glutamine; X = STOP. Therefore Q15X can be interpreted as "swap of glutamine for a stop codon at amino acid position 15", and if you count the amino acids below you will see that's exactly what's happened:

BTK-wt (164-215) DNA: ATGGCCGCAGTGATTCTGGAGAGCATCTTTCTGAAGCGATCCCAACAGAAA
RNA: AUG-GCC-GCA-GUG-AUU-CUG-GAG-AGC-AUC-UUU-CUG-AAG-CGA-UCC-CAA-CAG-AAA
AA: START-Ala-Ala-Val-Ile-Leu-Glu-Ser-Ile-Phe-Lue-Lys-Arg-Ser-Gln-Gln-Lys

BTK-Q15X (164-215) DNA: ATGGCCGCAGTGATTCTGGAGAGCATCTTTCTGAAGCGATCCTAACAGAAA
RNA: AUG-GCC-GCA-GUG-AUU-CUG-GAG-AGC-AUC-UUU-CUG-AAG-CGA-UCC-UAA-CAG-AAA
AA: START-Ala-Ala-Val-Ile-Leu-Glu-Ser-Ile-Phe-Lue-Lys-Arg-Ser-STOP

Now, I'm not sure without reading more literature whether the protein is actually expressed or not, because very often the cell will recognise that a protein which is "too short" isn't complete and will just recycle it, but the effect either way is the same: B-cells cannot mature and thus the person doesn't produce antibodies.

In most places, a SNP like this wouldn't be a problem. We have two copies of most chromosomes, and the other copy can normally "pick up the slack". For example, I mentioned CCR5 earlier. Most people have the genotype CCR5-wt/CCR5-wt (ie. they have two copies of the wild-type gene), but about 10% of the white, northern-European population have CCR5-wt/CCR5-Δ32.

The homozygous (genes are the same on both chromosomes) genotype (wt/wt) produce normal levels of CCR5 whereas the heterozygous (different gene versions on each chromosome) population (wt/Δ32) produce CCR5, but at lower levels.

About 1% of the white, northern-European population are homozygous for the Δ32 variant (Δ32/Δ32), and they don't express any CCR5. The heterozygotes are resistant to HIV infection; the Δ32 homozygotes are almost unable to be infected by HIV.

The problem with the gene being on the X chromosome is that us men only have one of them; women of course have two and unless both parents have the BTK-Q15X gene, are unaffected. However, men only need to inherit a single copy of the Q15X variant to be affected.

Q15X is considered to be "classic XLA", which is to say it is the type originally described by Bruton in 1952. The complications of this are those associated with XLA; no B-cells, no antibodies. It is thought that XLA patients may not have allergic disorders as they don't produce any IgE, which mediate allergic reactions.

Most "normal" tests to detect infection are worthless in people with XLA as they test to see if you have produced antibodies to pathogens and are therefore always negative; therefore, people with XLA should ALWAYS have the more expensive test which directly detect the pathogen. XLA isn't associated with other auto-immune diseases (unlike most PIDs).

Immunoglobulins: proteins that play tag

This was originally written (by me) as a post on the PIA Discussion Boards, and has been modified to fit the format of the blog.

When going through the process of getting diagnosed, many people hear their specialist talking to them about immunoglobulin levels, IgA, IgM and IgG. What are they? Why are they important?

Introduction to Immunoglobulins

Immunoglobulins are also known as antibody, and they are the body's adaptive way of responding to infection - particularly to bacterial infection, although they also respond to both viral and parasite infections. You can see on the right that the general structure of an immunoglobulin is that of a Y shape.

At the tip of each arm is a variable binding site: the tips of antibodies produced by different plasma cells bind to different protein fragments known as antigens. Since every type of pathogen consists of different proteins, this means that antibodies are specific to that type of pathogen.

Antibodies "tag" pathogens so that cells in the immune system can recognise them. You can think of immunoglobulins as adapters which fit between the pathogen and the immune cell; this adaptation is known as opsonisation. For opsonisation to work, the tail of the Y is constant and is recognised by a number of different cells in the immune system.

When a "normal" person gets an infection, the first wave (primary response) of antibodies takes about 3 days to start production; the antibodies of the primary response are IgM (immunoglobulin M). IgM consists of a cluster of five Y-shaped antibodies joined by the bottom of the Y in the middle (a pentamer). Because each IgM pentamer has 10 binding sites, it's very effective at creating clusters of tagged pathogens which stimulates the immune response. In addition, IgM can also bind with key parts of the pathogen which prevent them being pathogenic; for example, antibodies against influenza virus or HIV actually prevent the virus entering the cells.

After about 10 days, antibody production switches to IgG. IgG consists of 4 subclasses, all of which are Y shaped, only some have longer tails than others. The tips of the arms consist of a binding site again, but the IgG binding sites tend to be even more accurately shaped to bind with the target pathogen. This secondary response is also the one which provides long-term immunity; when a "normal" person is re-exposed to the same pathogen, the body immediately starts producing the IgG it previously used to destroy the bug. Again, IgG works both by opsonising pathogens and/or blocking their entry into cells.

IgA is also a refined antibody (that is to say, it's part of the secondary response, not part of the primary response), and consists of two Y-shaped antibodys tied together at the tail (a dimer). Again, the tips are binding sites so an IgA antibody has 4 binding sites. However, IgA is secreted into the mucosa - that's the moist tissues lining the nose, mouth, throat, lungs and digestive tract - where it works by blocking pathogens seeking an opportunity to enter the body.

Immune Problems and Immunoglobulins

The most common form of primary immune deficiency (PID) is selective IgA deficiency (SIgAD), although the vast majority of people with SIgAD don't have any symptoms. In SIgAD, the person produces little or no IgA, and can therefore be susceptible to repeated respiratory and digestive tract infections, including sinusitis, tonsilitis, pharyngitis, laryngitis, oral ulcers, bronchitis, bronchiolitis, pneumonia, food poisoning, vomitting and diarrhoea (not an exhaustive list).

One of the most common forms of PID is common variable immunodeficiency (commonly known as CVID, but also known as hypogammaglobulinaemia or agammaglobulinaemia). In CVID, patients have little or no IgG and may have low levels of IgM or IgA. In CVID, low levels of IgM result in the body not mounting an effective initial response to an infection; low IgG results in the body's ongoing fight against pathogens being impaired. Low IgG and IgA may also mean that the body doesn't respond to vaccinations - although in some cases it responds to some types but not others (for example, it may not respond to pneumonia vaccine, but respond successfully to the tetanus vaccine).

A related form of PID is hyper-IgM syndrome, in which the body produces only IgM, and never moves onto a secondary response.

Treatment

IgG-deficient disorders benefit from immunoglobulin replacement therapy, such as SCIG and IVIG. IgG therapy is generally well tolerated (few people have reactions) and improves the quality of life substantially, reducing infections, joint pain and fatigue (all common symptoms of CVID). There is no point in replacing IgM as it is less efficient than IgG.

IgA is more complex and is currently not treatable directly. Having said that, there is research into nasal-spray IgA supplements at the moment. There is a question as to whether this will work or not because as the IgA is secreted into the mucus it gains an extra molecule which wraps itself around the IgA antibody - and it's possible this molecule is important for the antibody to work or not be degraded by other chemicals in the mucus. We can produce IgA in volume using various techniques, but the secretory component is a potential problem.

Primary Immune Deficiency

Primary Immune Deficiencies (or PIDs as they are commonly known) are disorders in which the patient's immune defences are absent or decreased as a result of a problem of the body itself, normally as the result of a genetic problem. They are distinguished from secondary immune deficiencies because there is no mediating agent which gives rise to the problem, as occurs in Human Immunodeficiency Virus (HIV). There are many different PIDs ranging from the serious and life threatening (such as severe combined immunodeficiency or SCID) through to chronic symptomatic disorders (common variable immunodeficiency [CVID] and other a- and hypo-gammaglobulinaemias) through to subclinical conditions (the majority of cases of selective IgA deficiency). PIDs are confusing. There are lots of abbreviations, and immunology (the study of the immune system) is a complex topic which can be daunting when you are first diagnosed. As someone with CVID and with a background in the biological sciences, my aim here is to explain some of the terminology and outline how the disorders arise. I'll discuss what different types of cells do, and some of the most common treatment options. However, none of the advice on this site should be seen as a substitute for consulting with a qualified physician. I cannot possibly know the details of every individual's circumstances, and what is right for one patient may be inappropriate for another. For this reason, I also cannot enter into personal correspondence about a particular case.